If you have been reading about receptor targets and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Updated 2025-10-04. Numbers and descriptions here follow the published literature rather than marketing material.
Retatrutide is an investigational peptide studied for obesity and type 2 diabetes. It is a single synthetic molecule designed to activate three metabolic receptors simultaneously. The compound belongs to the incretin mimetic family, a group of peptides that imitate gut hormones involved in appetite and glucose control. Its research code is LY3437943, and it remains under clinical study rather than cleared for routine medical use.
Acting as a triple agonist, the molecule binds the GLP-1, GIP, and glucagon receptors. GLP-1 activity slows gastric emptying and dampens appetite, while GIP signaling contributes to insulin sensitivity and fat metabolism. Glucagon receptor engagement raises energy expenditure and encourages fat breakdown, although it can also elevate blood glucose. Combining three pathways is intended to yield larger weight reduction than single or dual agonists, and researchers continue to examine how the balance among them shapes tolerability.
Clinical studies have reported notable reductions in body weight among participants. Early trials measured safety and explored several dose levels, and later studies tracked body-weight change over months of treatment. Investigators also monitor effects on glycemic markers, liver fat, and blood lipids. Because the compound is still in development, questions about long-term safety, cardiovascular outcomes, and durability after treatment ends remain open.
Solid peptide is generally held as a lyophilised powder at low temperature to slow degradation, with desiccant to limit moisture uptake. Reconstituted solutions are less stable and are usually kept refrigerated and protected from light for short periods. Repeated freeze-thaw cycles are avoided because they encourage aggregation. Laboratory handling includes work in a fume hood or laminar flow cabinet to limit inhalation and contamination. Weighing and transfer steps are performed with antistatic tools to reduce static-driven loss of fine powder.
Characterising a peptide of this size relies on a combination of chromatographic and mass spectrometric techniques. Reversed-phase high-performance liquid chromatography separates the intact molecule from related impurities, while electrospray mass spectrometry confirms molecular mass and detects truncation or oxidation products. Peptide mapping after enzymatic digestion verifies the amino acid sequence and locates modified residues. Because the molecule carries a lipid chain, assays must also distinguish the correctly conjugated product from incompletely acylated species.
| Property | Value | Notes |
|---|---|---|
| Molecular weight | Approximately 4,700 Da | Peptide of roughly forty amino acids |
| Receptor targets | GLP-1, GIP, glucagon | Triple agonist class |
| Research code | LY3437943 | Internal development designation |
| Compound class | Incretin mimetic peptide | Synthetic, not a biologic extract |
| Development status | Investigational | No general regulatory approval |
Mechanistic proposals link each receptor to a different physiological role. Activation of the glucose-dependent insulinotropic polypeptide and glucagon-like peptide-1 receptors is associated with reduced appetite, slower gastric emptying, and glucose-dependent insulin release. Glucagon receptor signaling, by contrast, is associated with increased energy expenditure and altered lipid handling, though it can also raise blood glucose. The design intent is to balance these contributions so that weight reduction is enhanced without unacceptable glycemic trade-offs. How well that balance holds across individuals is not fully resolved.
Published information places retatrutide in clinical development rather than on the market as an approved therapy. Early-stage and mid-stage trials have examined tolerability and changes in body weight, and larger studies continue to report results over time. Open questions include the durability of effects after treatment stops, the composition of weight lost, and cardiovascular outcomes over long periods. Statements about definitive benefit should therefore be treated as provisional. Regulatory status varies by jurisdiction and changes as applications are reviewed.
Clinical development has progressed through phase 2 trials in adults with obesity and type 2 diabetes, with phase 3 programs reported as ongoing. Reported outcomes include reductions in body weight and improvements in glycemic measures over defined treatment periods. Whether these effects translate into durable benefits after treatment ends remains an open question. Long-term safety data across broad populations are not yet complete, and regulatory decisions have not been announced.
Retatrutide is an investigational synthetic peptide engineered to activate three distinct hormone receptors within a single molecule. It targets the glucose-dependent insulinotropic polypeptide receptor, the glucagon-like peptide-1 receptor, and the glucagon receptor simultaneously. This triagonist design distinguishes it from earlier incretin-based compounds that act on one or two of these pathways. Structural modifications relative to native gut hormones extend its residence time in circulation. The molecule remains under clinical evaluation and is not approved for any indication.
Development has progressed from single- and multiple-ascending-dose studies in healthy volunteers into larger randomized trials in adults with obesity, type 2 diabetes, and fatty liver disease. Early reports describe dose-dependent reductions in body weight and improvements in glycemic markers over treatment periods of several months. Whether the glucagon arm adds tolerability cost without added benefit is still debated. Long-term cardiovascular outcomes, effects after treatment stops, and performance in older or comorbid populations are open questions rather than settled findings. Approval status may change, so the current investigational label should be confirmed against regulatory sources.
Retatrutide is an investigational synthetic peptide developed under the code LY3437943, with a backbone derived from glucose-dependent insulinotropic polypeptide. Several non-proteinogenic residues, including alpha-aminoisobutyric acid, appear in that backbone, and a fatty diacid side chain attached through a linker extends circulation time. The molecule carries roughly thirty-nine amino acid units and a total mass near 4.7 kilodaltons. Administration is by subcutaneous injection once weekly. Published work uses both the name retatrutide and the code LY3437943.
Human evidence remains limited to controlled studies. A phase 2 trial in adults with obesity reported large, dose-dependent reductions in body weight over 48 weeks, with gastrointestinal events as the most frequently recorded adverse effect. Phase 3 programs designated TRIUMPH, for obesity, and TRANSCEND, for type 2 diabetes, are intended to confirm efficacy and to characterize safety in larger populations. Related studies are examining conditions such as knee osteoarthritis in people with obesity and metabolic liver disease. Open questions include long-term tolerability, effects on lean mass, and what happens after treatment is stopped.
Retatrutide is an investigational synthetic peptide that acts on three receptor targets at once: glucose-dependent insulinotropic polypeptide, glucagon-like peptide-1, and glucagon. It is developed by Eli Lilly and appears in the literature and in trial registries under the code LY3437943. The molecule belongs to a class of engineered peptides designed to resist rapid breakdown and permit infrequent subcutaneous administration. No regulatory agency has approved it for clinical use, and all available human data come from controlled trials rather than from routine practice.
The intended pharmacology combines three signals in one molecule. GLP-1 receptor activation reduces appetite and slows gastric emptying, effects already exploited by approved incretin-based therapies. GIP receptor engagement is associated with improved insulin sensitivity and with direct effects on adipose tissue, although how much it contributes to overall outcomes is still debated. Glucagon receptor agonism raises energy expenditure and supports hepatic lipid handling, a mechanism that also tends to increase glucose output. The triple profile is hypothesized to produce a larger metabolic effect than single or dual agonism, but the relative weight of each receptor in humans is not settled.
=== Threats to quality === TMA (tristeza y muerte de agave – "agave depression and death") is a blight that has reduced the production of the agave grown to produce tequila. This has resulted in lower production and higher prices throughout the early 21st century, and due to the long maturation of the plant, will likely continue to affect prices for years to come.
== History == MIKES was developed at Purdue University in 1973 by Beynon, Cooks, J. W. Amy, W. E. Baitinger, and T. Y. Ridley. MIKES was invented because researches at Purdue and Cornell thought that if the parent ion was mass-selected before the dissociation and mass analysis of the products by the electric sector it would be easier to study the metastable ions and the collision-induced dissociation (CID). This was an achievement because it combined the utility of previous instruments such as the ion kinetic energy spectrometer with the ability to mass select precursor ions. That precursor ion is mass selected with the magnetic sector. The dissociation products are then mass analyzed using the electric sector. "The peak shapes revealed from the electric sector scan can provide information on the kinetic energy release from in the course of fragmentation and on the kinetic energy uptake in the course of ionic collision processes." The dispersion of velocities due to kinetic energy release leads to the characteristic wide metastable peaks observed using MIKES techniques.
=== 19 February === Six people were killed by RSF shelling in Omdurman. The SAF claimed to have retaken the El Hurriya Bridge in central Khartoum, as well as Sidra in North Kordofan. The United Nations confirmed a state of famine in the Zamzam, Abu Shouk and Al Salam IDP camps in North Darfur, as well as in two locations in the Western Nuba Mountains.
=== Other treatments === Ozone therapy – There is only limited and poor-quality information available regarding the effectiveness of ozone therapy for treating foot ulcers in people with diabetes. Growth factors - There is some low-quality evidence that growth factors may increase the likelihood that diabetic foot ulcers will heal completely. Continuous diffusion of oxygen (CDO) - CDO delivers continuous oxygen to an occluded, moist wound site at much lower flow rates of 3–12 mL/h for 24 h 7 days a week for up to several weeks or months, depending on the wound status. Phototherapy - There is very weak evidence to suggest that people with foot ulcers due to diabetes may have improved healing. There is no evidence to suggest that phototherapy improves the quality of life for people with foot ulcers caused by diabetes. Sucrose-octasulfate impregnated dressing is recommended by the International Working Group on the Diabetic Foot Ulcer (IWGDF) for the treatment of non-infected, neuro-ischaemic diabetic foot ulcers that do not show an improvement with a standard of care regimen Autologous combined leucocyte, platelet and fibrin as an adjunctive treatment, in addition to best standard of care is also recommended by IWGDF However, there is only low quality evidence that such treatment is effective in treating diabetic foot ulcer. There is limited evidence that granulocyte colony-stimulating factor may not hasten the resolution of diabetic foot ulcer infection. However, it may reduce the need for surgical interventions such as amputations and hospitalizations.
Commercial motor vehicles such as cars, vans, trucks, specialist vehicles (such as mobile construction machinery), forklifts, and trailers Private vehicles used for work purposes (the 'grey fleet') Aviation machinery such as aircraft (planes and helicopters) Ships Rail cars Non-powered assets such as generators, tanks, gear boxes, dumpsters, shipping containers, trailers, excavators, and other equipment that can't run on its own power. Fleet (vehicle) management can include a range of functions, such as vehicle leasing and financing, vehicle maintenance, licensing and compliance, supply chain management, accident management and subrogation, vehicle telematics (tracking and diagnostics), driver management, speed management, fuel management, health and safety management, and vehicle re-marketing. Fleet Management is a function which allows companies which rely on transportation in business to remove or minimize the risks associated with vehicle investment, improving efficiency, productivity and reducing their overall transportation and staff costs, providing 100% compliance with government legislation (duty of care) and many more. These functions can be dealt with by either an in-house fleet-management department or an outsourced fleet-management provider. The number of light duty vehicles registered in commercial fleets in Europe as of 2016 was 15 million, and 19.5 million in North America. Even with these record numbers of registration, light duty vehicles represent only 62% of all fleet sales.
Sources: en.wikipedia.org
=== Bacterial nanocellulose === Some cellulose producing bacteria have also been used to produce nanocellulosic materials that are then referred to as bacterial nanocellulose. The most common examples being Medusomyces gisevii (the bacteria involved in the making of Kombucha) and Komagataeibacter xylinus (involve in the fabrication of Nata de coco), see bacterial cellulose for more details. This naming distinction might arise from the very peculiar morphology of these materials compared to the more traditional ones made of wood or cotton cellulose. In practice, bacterial nanocellulosic materials are often larger than their wood or cotton counterparts.
=== Objective list theories === Objective list theories state that a person's well-being depends on several factors. These factors can include subjective components, like pleasure and desire-satisfaction, but also encompass objective factors that enhance a person's well-being independent of whether they subjectively care about them. Objective list theorists have proposed diverse lists of items to cover a wide variety of elements contributing to well-being, such as health, friendship, achievement, knowledge, and autonomy. Some versions argue that each element on the list is valuable by itself, while others hold that they complement each other and only promote well-being when combined. One criticism of objective list theories asserts that they define an incoherent concept of well-being by including diverse elements that have little in common. Another objection challenges the proposed objectivity of objective list theories, arguing that well-being is essentially a subjective phenomenon. According to this view, what is good for a person depends on their subjective attitude, and imposing an external definition of what is good leads to alienation.
Bottlenecked by the time-consuming task of duct-tying dogs and waiting several weeks to extract insulin, Banting hit upon the idea of extracting insulin from the fetal calf pancreas, which had not yet developed digestive glands. By December, they had also succeeded in extracting insulin from the adult cow pancreas. Macleod discontinued all other research in his laboratory to concentrate on the purification of insulin. He invited biochemist James Collip to help with this task, and the team felt ready for a clinical test within a month.
== Chemistry == Volufralin is a semisynthetic analogue of limonoids from Neobeguea mahafalensis root bark such as libiguin A and libiguin B. Neobeguea mahafalensis has a long history of traditional use in Madagascar. In 2014, libiguin A and B were discovered via isolation from the roots of the plant and were found to cause "profound enhancement of sexual activity" in rodents. This specifically included having very high potency and a remarkably long-lasting duration in increasing mounting behavior in male rodents.
Sources: en.wikipedia.org
Urea labeled with carbon-14 or carbon-13 is used in the urea breath test, which is used to detect the presence of the bacterium Helicobacter pylori (H. pylori) in the stomach and duodenum of humans, associated with peptic ulcers. The test detects the characteristic enzyme urease, produced by H. pylori, by a reaction that produces ammonia from urea. This increases the pH (reduces the acidity) of the stomach environment around the bacteria. Similar bacteria species to H. pylori can be identified by the same test in animals such as apes, dogs, and cats (including big cats).
==== Group perceptions ==== Through further anthropological studies regarding "personal insights" and the psychosocial effects of psilocybin, it can be seen in many traditional societies that powerful mind-active substances such as psilocybin are regularly "consumed ritually for therapeutic purposes or for transcending normal, everyday reality". Positive effects that psilocybin has on individuals can be observed by taking on an anthropological approach and moving away from the Western biomedical view; this is aided by the studies done by Leary. Within certain traditional societies, where the use of psilocybin is frequent for shamanic healing rituals, group collectives praise their guide, healer and shaman for helping alleviate their pains, aches and hurt. They do this through a group ritual practice where the group, or just the guide, ingests psilocybin to help extract any "toxic psychic residues or sorcerous implants" found in one's body. Group therapies using "classic" psychedelics are becoming more common within clinical practice in the Western world. This is speculated to grow, provided the evidence remains indicative of their safety and efficacy. In social sense, the group is shaped by their experiences surrounding psilocybin and how they view the fungus collectively. As mentioned in the anthropology article, the group partakes in a "journey" together, thus adding to the spiritual, social body where roles, hierarchies and gender are subjectively understood.
=== Emulsion process === The concept of microemulsion is applied in this process. The transesterification involves sucrose and fatty acid methyl ester in a solvent, propylene glycol. A basic catalyst, such as anhydrous potassium carbonate, and soap, or a fatty acid salt, are added. The reaction is carried out at 130-135 °C. Propylene glycol is removed through distillation under vacuum at above 120 °C. The purified product is achieved by filtration. The yield of the reaction is 96%. 85% of sucrose esters is monosubstituted and 15% is disubstituted.
== Principle of operation == The typical nano-DESI probe setup consists of two fused silica capillaries – primary capillary, which supplies solvent and maintains a liquid bridge, and secondary capillary, which transports the dissolved analyte to the mass spectrometer. High voltage (several kV) is applied between the inlet of the mass spectrometer and the primary capillary, creating a self-aspirating nanospray. The liquid bridge is maintained by continuous flow of the solvent and the contact area between the solvent bridge and sample surface can be controlled by changing the solvent flow rate, varying the diameter of the utilized capillaries and regulating the distance between the sample and the nano-DESI probe. In this way, the spatial resolution in mass spectrometry imaging applications can be improved, with typical resolution ranging between 100–150 μm.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Sources: en.wikipedia.org
It is a synthetic peptide classified as a triple receptor agonist. It engages the GLP-1, GIP, and glucagon receptors at once. It is investigated for metabolic and weight-related conditions rather than approved for general use.
No regulatory agency has approved it for routine medical use. It remains an investigational compound studied in controlled trials. Access outside research settings is not established.
Each receptor influences energy balance through different pathways. Combining them is intended to add fat loss from lowered intake and higher expenditure. The optimal balance among the three effects is still under study.
Mass spectrometry provides the most direct confirmation of molecular mass. Reversed-phase chromatography adds a retention-time signature that supports identity when compared against a reference standard. No single method is sufficient on its own.